View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5898_high_3 (Length: 381)
Name: NF5898_high_3
Description: NF5898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5898_high_3 |
 |  |
|
| [»] scaffold0029 (7 HSPs) |
 |  |  |
|
| [»] scaffold0226 (3 HSPs) |
 |  |  |
|
| [»] scaffold1661 (3 HSPs) |
 |  |  |
|
| [»] scaffold0334 (2 HSPs) |
 |  |  |
|
| [»] scaffold0453 (2 HSPs) |
 |  |  |
|
| [»] scaffold0059 (3 HSPs) |
 |  |  |
|
| [»] scaffold0035 (2 HSPs) |
 |  |  |
|
| [»] scaffold0158 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (2 HSPs) |
 |  |  |
|
| [»] scaffold0974 (1 HSPs) |
 |  |  |
|
| [»] scaffold0861 (1 HSPs) |
 |  |  |
|
| [»] scaffold0773 (1 HSPs) |
 |  |  |
|
| [»] scaffold0582 (1 HSPs) |
 |  |  |
|
| [»] scaffold0566 (1 HSPs) |
 |  |  |
|
| [»] scaffold0512 (1 HSPs) |
 |  |  |
|
| [»] scaffold0375 (1 HSPs) |
 |  |  |
|
| [»] scaffold0230 (1 HSPs) |
 |  |  |
|
| [»] scaffold0156 (1 HSPs) |
 |  |  |
|
| [»] scaffold0096 (1 HSPs) |
 |  |  |
|
| [»] scaffold0056 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0020 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 5e-47; HSPs: 29)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 26 - 121
Target Start/End: Original strand, 15940717 - 15940812
Alignment:
| Q |
26 |
atatgcaagctaagttgcttgaggacaagcaacggttcaagtgtaggggagtttgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15940717 |
atatgcaagctaagttgcttgaggacaagcaacggttcaagtgtaggggagtttgataacacgtaaaatgcactattattttgactcatcttacac |
15940812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 151 - 230
Target Start/End: Original strand, 15932500 - 15932579
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattcg |
230 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15932500 |
gcaatgttatgttggtagtgtgtgtctatttcaggtatttatcggttaaaggtctccgcgcgtcaaaatgatgaaattcg |
15932579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 151 - 230
Target Start/End: Original strand, 15940842 - 15940921
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattcg |
230 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15940842 |
gcaatgttatgttggtagtgtgtgtctatttcaggtatttatcggttaaaggtctccgcgcgtcaaaatgatgaaattcg |
15940921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 305 - 363
Target Start/End: Original strand, 15932651 - 15932709
Alignment:
| Q |
305 |
cctgacctattctttccccacgtttcagaagcagtttgcccactttcttcattttctcc |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15932651 |
cctgacctattctttccccacgtttcagaagcagtttgcccactttcttcattttctcc |
15932709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 305 - 363
Target Start/End: Original strand, 15940993 - 15941051
Alignment:
| Q |
305 |
cctgacctattctttccccacgtttcagaagcagtttgcccactttcttcattttctcc |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15940993 |
cctgacctattctttccccacgtttcagaagcagtttgcccactttcttcattttctcc |
15941051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 151 - 229
Target Start/End: Original strand, 7157499 - 7157576
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattc |
229 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||| |||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7157499 |
gcaatgttatgctggtattgtgtgtctattttaggtatttattggttaaaggtctt-gcgcgtcaaaatgatgaaattc |
7157576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 175 - 229
Target Start/End: Complemental strand, 47922137 - 47922083
Alignment:
| Q |
175 |
tctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47922137 |
tctatttcaggtatttatcggttaaaggtctccgcgcgtcaaaatgatgaaattc |
47922083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 305 - 363
Target Start/End: Original strand, 7157650 - 7157708
Alignment:
| Q |
305 |
cctgacctattctttccccacgtttcagaagcagtttgcccactttcttcattttctcc |
363 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
7157650 |
cctgaccaattctttccccacttttcagaagcagtttgcccacttccttcgttttctcc |
7157708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 29 - 87
Target Start/End: Original strand, 1826246 - 1826304
Alignment:
| Q |
29 |
tgcaagctaagttgcttgaggacaagcaacggttcaagtgtaggggagtttgataacac |
87 |
Q |
| |
|
|||||||||| |||||| ||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
1826246 |
tgcaagctaaattgctttaggacaagcaattgttcaagtgtaggggactttgataacac |
1826304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 79 - 121
Target Start/End: Original strand, 15932428 - 15932470
Alignment:
| Q |
79 |
tgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15932428 |
tgataacatgtaaaatgcactattattttgactcatcttacac |
15932470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 78 - 121
Target Start/End: Original strand, 7157426 - 7157469
Alignment:
| Q |
78 |
ttgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7157426 |
ttgataacacgtaaaatgcactattattttgactagtcttacac |
7157469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 5397288 - 5397330
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
5397288 |
ttgcttgaggacaagcaaagattcaagtgtaggggagtttgat |
5397330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 79 - 121
Target Start/End: Complemental strand, 47922224 - 47922182
Alignment:
| Q |
79 |
tgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
47922224 |
tgataacacataaaatgcactattattttgactcgtcttacac |
47922182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 538798 - 538756
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
538798 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
538756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 825796 - 825838
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
825796 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
825838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 4312729 - 4312771
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
4312729 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
4312771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 8718037 - 8718079
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
8718037 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
8718079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 9583065 - 9583107
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
9583065 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
9583107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 11921350 - 11921308
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
11921350 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
11921308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 12548848 - 12548806
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
12548848 |
ttgcttgaggacaagcaaagattcaagtgttggggagtttgat |
12548806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 13658038 - 13658080
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
13658038 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
13658080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 14221761 - 14221719
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
14221761 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
14221719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 14551271 - 14551313
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
14551271 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
14551313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 15065941 - 15065983
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
15065941 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
15065983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 15916819 - 15916777
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
15916819 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
15916777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 16119892 - 16119850
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
16119892 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
16119850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 16465659 - 16465617
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
16465659 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
16465617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 18287774 - 18287816
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
18287774 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
18287816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 27291509 - 27291551
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
27291509 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
27291551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029 (Bit Score: 92; Significance: 1e-44; HSPs: 7)
Name: scaffold0029
Description:
Target: scaffold0029; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 26 - 121
Target Start/End: Complemental strand, 77447 - 77352
Alignment:
| Q |
26 |
atatgcaagctaagttgcttgaggacaagcaacggttcaagtgtaggggagtttgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
77447 |
atatgcaagctaagttgcttgaggacaagcaatggttcaagtgtaggggagtttgataacacgtaaaatgcactattattttgactcatcttacac |
77352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 151 - 230
Target Start/End: Complemental strand, 88928 - 88849
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattcg |
230 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
88928 |
gcaatgttatgctggtagtgtgtgtctatttcaggtatttatcggttaaaggtctccgcgcgtcaaaatgatgaaattcg |
88849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029; HSP #3
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 151 - 230
Target Start/End: Complemental strand, 77321 - 77242
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattcg |
230 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
77321 |
gcaatgttatgctggtagtgtgtgtctatttcaggtatttatcagttaaaggtctccgcgcgtcaaaatgatgaaattcg |
77242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 363
Target Start/End: Complemental strand, 88777 - 88719
Alignment:
| Q |
305 |
cctgacctattctttccccacgtttcagaagcagtttgcccactttcttcattttctcc |
363 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
88777 |
cctgacctattcttttcccacgtttcagaagcagtttgcccactttcttcattttctcc |
88719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 121
Target Start/End: Complemental strand, 89001 - 88959
Alignment:
| Q |
79 |
tgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
89001 |
tgataacacgtaaaatgcactattattttgactcatcttacac |
88959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 305 - 343
Target Start/End: Complemental strand, 77170 - 77132
Alignment:
| Q |
305 |
cctgacctattctttccccacgtttcagaagcagtttgc |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
77170 |
cctgacctattctttccccacgtttcagaagcagtttgc |
77132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 123541 - 123583
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
123541 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
123583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 89; Significance: 8e-43; HSPs: 19)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 26 - 114
Target Start/End: Complemental strand, 19902230 - 19902142
Alignment:
| Q |
26 |
atatgcaagctaagttgcttgaggacaagcaacggttcaagtgtaggggagtttgataacacgtaaaatgcactattattttgactcat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19902230 |
atatgcaagctaagttgcttgaggacaagcaacggttcaagtgtaggggagtttgataacacgtaaaatgcactattattttgactcat |
19902142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 151 - 229
Target Start/End: Complemental strand, 19902105 - 19902027
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattc |
229 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
19902105 |
gcaatgttatgttggtagtgtgtgtctatttcaggtatttatcggttaaaggtctccgcgcgttaaaatgatgaaattc |
19902027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 363
Target Start/End: Complemental strand, 19901954 - 19901896
Alignment:
| Q |
305 |
cctgacctattctttccccacgtttcagaagcagtttgcccactttcttcattttctcc |
363 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19901954 |
cctgacctattctttccccacgttttagaagcagtttgcccactttcttcattttctcc |
19901896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 22102565 - 22102607
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
22102565 |
ttgcttgaggacaagcaaagattcaagtgtaggggagtttgat |
22102607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 151 - 206
Target Start/End: Original strand, 40755908 - 40755963
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtctt |
206 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||||| |||| |||||||||| |||| |
|
|
| T |
40755908 |
gcaatgttatgctggtattgtgtgtctatttcaggcatttgtcggttaaagttctt |
40755963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 11346996 - 11346954
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
11346996 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
11346954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 29 - 98
Target Start/End: Original strand, 19352475 - 19352544
Alignment:
| Q |
29 |
tgcaagctaagttgcttgag-gacaagcaacggttcaagtgtaggggagtttgataacacgtaaaatgcac |
98 |
Q |
| |
|
|||||||||||||||||||| | |||||| ||||||||||| |||||||||||||| | | ||||||||| |
|
|
| T |
19352475 |
tgcaagctaagttgcttgagatataagcaatggttcaagtgt-ggggagtttgataagatgcaaaatgcac |
19352544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 19767697 - 19767739
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
19767697 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
19767739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 20002287 - 20002329
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
20002287 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
20002329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 20039024 - 20038982
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
20039024 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
20038982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 20712606 - 20712648
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||||||||| |
|
|
| T |
20712606 |
ttgcttgaggacaagcaaagatttaagtgtaggggagtttgat |
20712648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 21098837 - 21098795
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
21098837 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
21098795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 21104158 - 21104116
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
21104158 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
21104116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 21831189 - 21831231
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
21831189 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
21831231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 21843567 - 21843525
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
21843567 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
21843525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 22033598 - 22033556
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
22033598 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
22033556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 22099698 - 22099656
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
22099698 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
22099656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 22370115 - 22370157
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
22370115 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
22370157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 79 - 107
Target Start/End: Original strand, 40755836 - 40755864
Alignment:
| Q |
79 |
tgataacacgtaaaatgcactattatttt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40755836 |
tgataacacgtaaaatgcactattatttt |
40755864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0226 (Bit Score: 84; Significance: 8e-40; HSPs: 3)
Name: scaffold0226
Description:
Target: scaffold0226; HSP #1
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 26 - 121
Target Start/End: Original strand, 3237 - 3332
Alignment:
| Q |
26 |
atatgcaagctaagttgcttgaggacaagcaacggttcaagtgtaggggagtttgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3237 |
atatgcaagcaaagttgcttgaggacaagcaacggttcaagtgtaggggagtttgttaacacgtaaaatgcactattattttgactcgtcttacac |
3332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0226; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 151 - 230
Target Start/End: Original strand, 3362 - 3441
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattcg |
230 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||||||||||||| ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
3362 |
gcaatgttatgctggtattgtgtgtctatttcaggtatttatcagttaaaggtctcagtgcgtcaaaatgatgaaattcg |
3441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0226; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 308 - 363
Target Start/End: Original strand, 3515 - 3570
Alignment:
| Q |
308 |
gacctattctttccccacgtttcagaagcagtttgcccactttcttcattttctcc |
363 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||| || |||||||||| |
|
|
| T |
3515 |
gaccaattctttccccacatttcagaagcagtttgcccacttcctccattttctcc |
3570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1661 (Bit Score: 68; Significance: 3e-30; HSPs: 3)
Name: scaffold1661
Description:
Target: scaffold1661; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 151 - 230
Target Start/End: Complemental strand, 438 - 359
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattcg |
230 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
438 |
gcaatgttattttggtagtgtgtgtctatttcaggtatttatcggttaaaggtctccgcgcgtcaaaatgatgaaattcg |
359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1661; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 363
Target Start/End: Complemental strand, 287 - 229
Alignment:
| Q |
305 |
cctgacctattctttccccacgtttcagaagcagtttgcccactttcttcattttctcc |
363 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
287 |
cctgacctattcttttcccacgtttcagaagcagtttgcccactttcttcattttctcc |
229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1661; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 121
Target Start/End: Complemental strand, 511 - 469
Alignment:
| Q |
79 |
tgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
511 |
tgataacacgtaaaatgcactattattttgactcatcttacac |
469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 68; Significance: 3e-30; HSPs: 21)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 151 - 230
Target Start/End: Complemental strand, 20934576 - 20934497
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattcg |
230 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20934576 |
gcaatgttatgtcggtagtgtgtgtctatttcaggtatttatcggttaaaggtctccgcgcgtcaaaatgatgaaattcg |
20934497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 151 - 230
Target Start/End: Original strand, 34656920 - 34656999
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattcg |
230 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
34656920 |
gcaatgttatgctggtattgtgtgtctatttcaggtatttatcggttaaaggtctccacgcgtcaaaatgatgaaattcg |
34656999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 305 - 363
Target Start/End: Complemental strand, 20934425 - 20934367
Alignment:
| Q |
305 |
cctgacctattctttccccacgtttcagaagcagtttgcccactttcttcattttctcc |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20934425 |
cctgacctattctttccccacgtttcagaagcagtttgcccactttcttcattttctcc |
20934367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 305 - 363
Target Start/End: Original strand, 34657071 - 34657129
Alignment:
| Q |
305 |
cctgacctattctttccccacgtttcagaagcagtttgcccactttcttcattttctcc |
363 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34657071 |
cctgaccaattctttccccacgtttcagaagcagtttgcccacttccttcattttctcc |
34657129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 121
Target Start/End: Complemental strand, 20934648 - 20934606
Alignment:
| Q |
79 |
tgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20934648 |
tgataacacgtaaaatgcactattattttgactcatcttacac |
20934606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 29 - 99
Target Start/End: Complemental strand, 26306926 - 26306856
Alignment:
| Q |
29 |
tgcaagctaagttgcttgaggacaagcaacggttcaagtgtaggggagtttgataacacgtaaaatgcact |
99 |
Q |
| |
|
|||||||||| ||| ||||||||||| || ||||||||||| || |||||||||||||||||||| |||| |
|
|
| T |
26306926 |
tgcaagctaaattgtttgaggacaagtaatggttcaagtgtgaggtagtttgataacacgtaaaatacact |
26306856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 40 - 94
Target Start/End: Original strand, 27270565 - 27270619
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgataacacgtaaaat |
94 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||||||||| ||||| |
|
|
| T |
27270565 |
ttgcttgaggacaagcaatgattcaagtgtgggggagtttgataacacgcaaaat |
27270619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 79 - 121
Target Start/End: Original strand, 34656848 - 34656890
Alignment:
| Q |
79 |
tgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34656848 |
tgattacacgtaaaatgcactattattttgactcgtcttacac |
34656890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 79 - 112
Target Start/End: Original strand, 31232012 - 31232045
Alignment:
| Q |
79 |
tgataacacgtaaaatgcactattattttgactc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31232012 |
tgataacacgtaaaatgcactattattttgactc |
31232045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 175 - 227
Target Start/End: Original strand, 31232101 - 31232153
Alignment:
| Q |
175 |
tctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaat |
227 |
Q |
| |
|
|||||||||||||||| | ||||||||||| |||| |||||||||||||||| |
|
|
| T |
31232101 |
tctatttcaggtatttgttggttaaaggtcgccgcgggtcaaaatgatgaaat |
31232153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 163 - 230
Target Start/End: Original strand, 19183698 - 19183765
Alignment:
| Q |
163 |
tggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattcg |
230 |
Q |
| |
|
||||| ||||| |||||||||||||| | | | ||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
19183698 |
tggtattgtgtgtctatttcaggtatatgttgattaaaagtctttgcgcgtcaaaatgatgagattcg |
19183765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 15735706 - 15735748
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
15735706 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
15735748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 18484255 - 18484213
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
18484255 |
ttgcttgaggacaagcaaagattcaagtgttggggagtttgat |
18484213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 20595874 - 20595832
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
20595874 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
20595832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 20602160 - 20602118
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
20602160 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
20602118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 20608451 - 20608409
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
20608451 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
20608409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 22317556 - 22317514
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
22317556 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
22317514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 25006851 - 25006809
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
25006851 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
25006809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 25116214 - 25116172
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
25116214 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
25116172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 25175304 - 25175262
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
25175304 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
25175262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 30759698 - 30759656
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
30759698 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
30759656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 3e-30; HSPs: 18)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 151 - 230
Target Start/End: Complemental strand, 11178012 - 11177933
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattcg |
230 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
11178012 |
gcaatgttatgttggtagtgtgtgtctatttcaggtatttatcggttaaaggtctccgcgcgtcaaaatgttgaaattcg |
11177933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 305 - 363
Target Start/End: Complemental strand, 11177861 - 11177803
Alignment:
| Q |
305 |
cctgacctattctttccccacgtttcagaagcagtttgcccactttcttcattttctcc |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11177861 |
cctgacctattctttccccacgtttcagaagcagtttgcccactttcttcattttctcc |
11177803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 151 - 230
Target Start/End: Original strand, 23046403 - 23046482
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattcg |
230 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||| | | | ||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
23046403 |
gcaatgttatgttggtattgtgtgtctatttcaggtatatgttgattaaaagtctttgcgcgtcaaaatgatgtaattcg |
23046482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 121
Target Start/End: Complemental strand, 11178084 - 11178042
Alignment:
| Q |
79 |
tgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11178084 |
tgataacacgtaaaatgcactattattttgactcatcttacac |
11178042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 3245631 - 3245589
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
3245631 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
3245589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 3339269 - 3339227
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
3339269 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
3339227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 4382918 - 4382960
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
4382918 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
4382960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 10546979 - 10546937
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
10546979 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
10546937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 10602515 - 10602473
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
10602515 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
10602473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 12160250 - 12160208
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
12160250 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
12160208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 12776577 - 12776535
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
12776577 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
12776535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 13001468 - 13001426
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
13001468 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
13001426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 13136253 - 13136211
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
13136253 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
13136211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 13504924 - 13504882
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
13504924 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
13504882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 14348631 - 14348589
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
14348631 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
14348589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 15946781 - 15946823
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
15946781 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
15946823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 20584275 - 20584317
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
20584275 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
20584317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 27356771 - 27356729
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
27356771 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
27356729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 62; Significance: 1e-26; HSPs: 17)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 26 - 107
Target Start/End: Complemental strand, 50882191 - 50882110
Alignment:
| Q |
26 |
atatgcaagctaagttgcttgaggacaagcaacggttcaagtgtaggggagtttgataacacgtaaaatgcactattatttt |
107 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||| ||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
50882191 |
atatgcaagctaagttgcttgaagacaagtaacggttcaggtgtaggggagtttgataacacgtaaaatacactactatttt |
50882110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 157 - 229
Target Start/End: Original strand, 11163937 - 11164009
Alignment:
| Q |
157 |
ttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattc |
229 |
Q |
| |
|
||||| ||||| ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11163937 |
ttatgctggtattgtgtgtctatttcaggtatttatcggttaaaggtctccgcgcgtcaaaatgatgaaattc |
11164009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 79 - 121
Target Start/End: Original strand, 11163887 - 11163929
Alignment:
| Q |
79 |
tgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11163887 |
tgataacacgtaaaatgcactattattttgactcgtcttacac |
11163929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 40 - 86
Target Start/End: Original strand, 14233259 - 14233305
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgataaca |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
14233259 |
ttgcttgaggacaagcaatggttcaagtataggggagtttgataaca |
14233305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 151 - 230
Target Start/End: Original strand, 16635464 - 16635543
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattcg |
230 |
Q |
| |
|
||||||||||| ||||| || || |||||||||||||| | | | ||||| |||| || |||||||||||||||||||| |
|
|
| T |
16635464 |
gcaatgttatgctggtattgcgtgtctatttcaggtatctgtggattaaaagtctctgcacgtcaaaatgatgaaattcg |
16635543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 3354812 - 3354854
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
3354812 |
ttgcttgaggacaagcaactattcaagtgtgggggagtttgat |
3354854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 10630922 - 10630964
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
10630922 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
10630964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 11496657 - 11496615
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
11496657 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
11496615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 13823085 - 13823127
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
13823085 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
13823127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 14654041 - 14653999
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
14654041 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
14653999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 15254520 - 15254562
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
15254520 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
15254562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 17484953 - 17484911
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
17484953 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
17484911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 18081502 - 18081460
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
18081502 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
18081460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 38426895 - 38426937
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
38426895 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
38426937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 42709774 - 42709732
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
42709774 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
42709732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 56580582 - 56580540
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
56580582 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
56580540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 81
Target Start/End: Original strand, 15865660 - 15865701
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttga |
81 |
Q |
| |
|
|||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
15865660 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttga |
15865701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 56; Significance: 4e-23; HSPs: 2)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 151 - 230
Target Start/End: Original strand, 15954 - 16033
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattcg |
230 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15954 |
gcaatgttatgctggtattgtgtgtctatttcaaatatttatcggttaaaggtctttgcgcgtcaaaatgatgaaattcg |
16033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 79 - 121
Target Start/End: Original strand, 15881 - 15923
Alignment:
| Q |
79 |
tgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15881 |
tgataacacgtaaaatgcactattattttgactcgtcttacac |
15923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0453 (Bit Score: 51; Significance: 4e-20; HSPs: 2)
Name: scaffold0453
Description:
Target: scaffold0453; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 151 - 229
Target Start/End: Original strand, 9430 - 9508
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattc |
229 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||| ||||||||| ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
9430 |
gcaatgttatgctggtattgtgtgtctatttcgggtatttattggttataggtctccgcgcgtcaaaatgatgaaattc |
9508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0453; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 79 - 121
Target Start/End: Original strand, 9358 - 9400
Alignment:
| Q |
79 |
tgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9358 |
tgataacacgtaaaatgcactattattttgactcgtcttacac |
9400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 6e-19; HSPs: 13)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 17334659 - 17334587
Alignment:
| Q |
29 |
tgcaagctaagttgcttgaggacaagcaacggttcaagtgtaggggagtttgataacacgtaaaatgcactat |
101 |
Q |
| |
|
|||||||||| |||||||||||||| ||| ||||||||||| |||||||||||||||| | |||||||||||| |
|
|
| T |
17334659 |
tgcaagctaaattgcttgaggacaatcaatggttcaagtgtgggggagtttgataacaagcaaaatgcactat |
17334587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 151 - 230
Target Start/End: Original strand, 23689109 - 23689188
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattcg |
230 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||||| |||| | ||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
23689109 |
gcaatgttatgatggtattgtgtgtctatttcagatattcgttggttaaaggtcgtcgcacgtcaaaatgatgaaattcg |
23689188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 40 - 94
Target Start/End: Complemental strand, 19805660 - 19805606
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgataacacgtaaaat |
94 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
19805660 |
ttgcttgaggacaagcaatggttctagtgtgggggagtttgataacacgcaaaat |
19805606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 5500308 - 5500266
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
5500308 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
5500266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 22665234 - 22665276
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
22665234 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
22665276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 23159428 - 23159386
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
23159428 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
23159386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 23570685 - 23570643
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
23570685 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
23570643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 23644117 - 23644159
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
23644117 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
23644159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 24171518 - 24171560
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
24171518 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
24171560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 25144800 - 25144758
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
25144800 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
25144758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 25804310 - 25804268
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
25804310 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
25804268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 27631668 - 27631710
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
27631668 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
27631710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 27768859 - 27768817
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
27768859 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
27768817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0059 (Bit Score: 47; Significance: 1e-17; HSPs: 3)
Name: scaffold0059
Description:
Target: scaffold0059; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 151 - 229
Target Start/End: Complemental strand, 39441 - 39363
Alignment:
| Q |
151 |
gcaatgttatgttggtagtgtgtctctatttcaggtatttatcggttaaaggtcttcgcgcgtcaaaatgatgaaattc |
229 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||||||||||||| ||| ||||||| | |||||||||||||||||||| |
|
|
| T |
39441 |
gcaatgttatgctggtattgtgtgtctatttcaggtatttatctgtttaaggtctctgtgcgtcaaaatgatgaaattc |
39363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0059; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 78 - 121
Target Start/End: Complemental strand, 39514 - 39471
Alignment:
| Q |
78 |
ttgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39514 |
ttgataacacgtaaaatgcactattattttgactcgtcttacac |
39471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0059; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 313 - 363
Target Start/End: Complemental strand, 39283 - 39233
Alignment:
| Q |
313 |
attctttccccacgtttcagaagcagtttgcccactttcttcattttctcc |
363 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| || |||||||||| |
|
|
| T |
39283 |
attctttccccacatttcagaagcagtttgcccacttcctccattttctcc |
39233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 40 - 86
Target Start/End: Complemental strand, 88403 - 88357
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgataaca |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
88403 |
ttgcttgaggacaagcaatggttcaagtgtaggggagtttgataaca |
88357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 50549 - 50507
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
50549 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
50507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 40 - 86
Target Start/End: Complemental strand, 18478276 - 18478230
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgataaca |
86 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18478276 |
ttgcttgaggacaagcaatggttcaagtgtaggggagtttgataaca |
18478230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 17094644 - 17094602
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
17094644 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
17094602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 79 - 121
Target Start/End: Complemental strand, 17951384 - 17951342
Alignment:
| Q |
79 |
tgataacacgtaaaatgcactattattttgactcatcttacac |
121 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
17951384 |
tgataacacgtaaaatgcactattatttttactcgacttacac |
17951342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 19364201 - 19364243
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
19364201 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
19364243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 20237628 - 20237670
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
20237628 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
20237670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 27047046 - 27047088
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
27047046 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
27047088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 52938664 - 52938622
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
52938664 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
52938622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0158 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0158
Description:
Target: scaffold0158; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 40 - 86
Target Start/End: Complemental strand, 31472 - 31426
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgataaca |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
31472 |
ttgcttgaggacaagcaatggttcaagtttaggggagtttgataaca |
31426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 84
Target Start/End: Original strand, 172274 - 172318
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgataa |
84 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||||| |
|
|
| T |
172274 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgataa |
172318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 162015 - 162057
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
162015 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
162057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0974 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0974
Description:
Target: scaffold0974; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 1275 - 1317
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
1275 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
1317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0861 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0861
Description:
Target: scaffold0861; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 927 - 969
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
927 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0773 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0773
Description:
Target: scaffold0773; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 644 - 686
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
644 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0582 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0582
Description:
Target: scaffold0582; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 8826 - 8868
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
8826 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
8868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0566 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0566
Description:
Target: scaffold0566; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 2775 - 2817
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
2775 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
2817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0512 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0512
Description:
Target: scaffold0512; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 5252 - 5294
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
5252 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
5294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0375 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0375
Description:
Target: scaffold0375; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 12751 - 12793
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
12751 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
12793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0230 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0230
Description:
Target: scaffold0230; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 15850 - 15892
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
15850 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
15892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0156 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0156
Description:
Target: scaffold0156; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 998 - 1040
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
998 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
1040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0096 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0096
Description:
Target: scaffold0096; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 38551 - 38509
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
38551 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
38509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 42257 - 42299
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
42257 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
42299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 22775 - 22817
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
22775 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
22817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0020 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 121119 - 121161
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
121119 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
121161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 9)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 2181226 - 2181268
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
2181226 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
2181268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 15699727 - 15699769
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
15699727 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
15699769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 18448306 - 18448348
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
18448306 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
18448348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 22165592 - 22165550
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
22165592 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
22165550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 22243984 - 22244026
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
22243984 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
22244026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 23023259 - 23023301
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
23023259 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
23023301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 25963414 - 25963456
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
25963414 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
25963456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 25968061 - 25968103
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
25968061 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
25968103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Complemental strand, 30671850 - 30671808
Alignment:
| Q |
40 |
ttgcttgaggacaagcaacggttcaagtgtaggggagtttgat |
82 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
30671850 |
ttgcttgaggacaagcaaagattcaagtgtgggggagtttgat |
30671808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University