View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5898_low_9 (Length: 216)
Name: NF5898_low_9
Description: NF5898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5898_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 16977714 - 16977523
Alignment:
| Q |
17 |
caatgatgaagttgagcattcagattatggtagtgtagcaatttctaatgcctttgagaagaagaaggattcttttgtacacactgatgaagtggagcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16977714 |
caatgatgaagttgagcattcagattatggtagtgtagcaatttctaatgcctttgagaagaagaaggattcttttgtacacactgatgaagtggagcat |
16977615 |
T |
 |
| Q |
117 |
tcagatcgaataaagggttcttcttcttcttcaaaccagaaggaaatatcagatatacaaaaggcagtgcaaaatgtctctgatgatgatgt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16977614 |
tcagatcgaataaagggttcttcttcttcttcaaaccagaaggaaatatcagatatacaaagggcagtgcaaaatgtctctgatgatgatgt |
16977523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 10601907 - 10601969
Alignment:
| Q |
18 |
aatgatgaagttgagcattcagattatggtagtgtagcaatttctaatgcctttgagaagaag |
80 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||| | |||||||||||||| |
|
|
| T |
10601907 |
aatgatgaagtggagcattcagattatggtagtgtagcaacttctactacctttgagaagaag |
10601969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University