View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5899_low_12 (Length: 238)
Name: NF5899_low_12
Description: NF5899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5899_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 6 - 216
Target Start/End: Complemental strand, 52445333 - 52445123
Alignment:
| Q |
6 |
tcgttctcgtggacaaatttaagtatgttagaaaggtcatactttacaaaggagtggctgagcatgaatatcatatggatgtcatcaagaatgacattgt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
52445333 |
tcgttctcgtggacaaatttaagtatgttagaaaggtcatactttacgaaggagtggctgagcatggatatcatatggatgtcatcaagaatgacattat |
52445234 |
T |
 |
| Q |
106 |
gtacgagcatgacatggctgacaagtccgtggagcagtgcatgatgcaaattagggtcatgcacaggcgtggcagtgcaacaccttatctttgtgttagg |
205 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52445233 |
gtacgagcatgacatggctgacaagtacgtggagcagtgcatgatgcaaattaaggtcatgcacaggcgtggcagtgcaacaccttatctttgtgttagg |
52445134 |
T |
 |
| Q |
206 |
attgctaaggt |
216 |
Q |
| |
|
||||||||||| |
|
|
| T |
52445133 |
attgctaaggt |
52445123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University