View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5899_low_15 (Length: 204)
Name: NF5899_low_15
Description: NF5899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5899_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 17 - 194
Target Start/End: Original strand, 44891123 - 44891300
Alignment:
| Q |
17 |
aattatatgtggtactcacttccacttttatatcatacatccatttactcactctcttgactacacgatgtaggactaactagtattgttcagcaccaat |
116 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44891123 |
aattatatgtggtactcacttctacttttatatcatacatccatttactcactctcttgactacacgatgtaggactaactagtattgttcagcaccaac |
44891222 |
T |
 |
| Q |
117 |
ttgcttcgtggactcacttggtagactatattcagtctttcttctcttatctatattcgttttcttccaatattcttc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44891223 |
ttgcttcgtggactcacttggtagactatattcagtctttcttctcttatctatattcgttttcttccaatgttcttc |
44891300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University