View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5900-Insertion-10 (Length: 52)
Name: NF5900-Insertion-10
Description: NF5900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5900-Insertion-10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.000000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.000000000000003
Query Start/End: Original strand, 12 - 52
Target Start/End: Complemental strand, 46708503 - 46708463
Alignment:
| Q |
12 |
tttcgactttatttgctgctaactatgtcttcacttgtaac |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46708503 |
tttcgactttatttgctgctaactatgtcttcacttgtaac |
46708463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University