View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5900_high_16 (Length: 251)

Name: NF5900_high_16
Description: NF5900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5900_high_16
NF5900_high_16
[»] chr4 (1 HSPs)
chr4 (15-234)||(1223942-1224161)


Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 15 - 234
Target Start/End: Complemental strand, 1224161 - 1223942
Alignment:
15 aaaccgcagaatttgttgctggatcaagcgaaagggattttgaagattgctgatttagggcttggaagagcttttactgtgccgttgaaaagttatactc 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1224161 aaaccgcagaatttgttgctggatcaagcgaaagggattttgaagattgctgatttagggcttggaagagcttttactgtgccgttgaaaagttatactc 1224062  T
115 atgagattgttactctttggtatagagctcctgaggttttgcttggttcttctacttactctactggtgttgatatttggtctgttggatgtatctttgg 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
1224061 atgagattgttactctttggtatagagctcctgaggttttgcttggttcttctacttactctactagtgttgatatttggtctgttggatgtatctttgg 1223962  T
215 tgagtcatttccccgttcaa 234  Q
    ||||||||||||||||||||    
1223961 tgagtcatttccccgttcaa 1223942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University