View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5900_high_5 (Length: 379)
Name: NF5900_high_5
Description: NF5900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5900_high_5 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 313; Significance: 1e-176; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 55 - 379
Target Start/End: Original strand, 8201993 - 8202317
Alignment:
| Q |
55 |
tttattgtagcaaattttcaagtgactagcagatttgccgaaggcttattcttcttatgaaatgaatcgtcatcacttagcaatgattacacttgtaaat |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8201993 |
tttattgtagcaaattttcaagtgactagcagatttgcctaaggcttattcttcttatgaaatgaatcgtcatcacttagcaatgattacacttgtaaat |
8202092 |
T |
 |
| Q |
155 |
tcagttattcggttattccttttagtctttaagctaatatgctgtcatgttgtgtttttgttgcattctgtttcacagtttcatgtgatcaaaactcgga |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8202093 |
tcagttattcggttattccttttagtctttaagctaatatgctgtcatgttgtgtttttgttgcattctgtttcacagtttcatgtgatcaaaactcgga |
8202192 |
T |
 |
| Q |
255 |
ctgatacctgtaggaaaagggtcagcgatatttttaatctatgatccagttttttcttgctcttgtgaatttgataaaccaatgttctattaaaacttta |
354 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8202193 |
ctgatacctgtaggaaaaaggtcagcaatatttttaatctatgatccagttttttcttgctcttgtgaatttgataaaccaatgttctattaaaacttta |
8202292 |
T |
 |
| Q |
355 |
tctaaataatatgcaggttagaagc |
379 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8202293 |
tctaaataatatgcaggttagaagc |
8202317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 8201810 - 8201852
Alignment:
| Q |
18 |
cttcaaattctttaatttgttcaattctataattctctttatt |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8201810 |
cttcaaattctttaatttgttcaattctataattctctttatt |
8201852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University