View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5900_low_19 (Length: 250)
Name: NF5900_low_19
Description: NF5900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5900_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 42 - 247
Target Start/End: Complemental strand, 54969054 - 54968849
Alignment:
| Q |
42 |
agatttgtaaatataaatagaactgcttatttctttattacat-atcaattattacattttattatnnnnnnntacaacaaannnnnnnnagttaaataa |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
54969054 |
agatttgtaaatataaatagaactgcttatttctttattacattatcaattattacattttattataaaaaag-acaacaaattttttttagttaaataa |
54968956 |
T |
 |
| Q |
141 |
attgttcaaaattaaagaaagaggtgatttcgaaagaaaattaatgctcttaaggattcaactttgaaggcagtgcacgtcaaattacttcttaagaata |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
54968955 |
attgttcaaaattaaagaaagaggtgatttcgaaagaaaattaatgctcttaaggattcaactttgagggcagtgcacgtcaaattacttcttaagaaaa |
54968856 |
T |
 |
| Q |
241 |
atttacc |
247 |
Q |
| |
|
||||||| |
|
|
| T |
54968855 |
atttacc |
54968849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University