View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5900_low_23 (Length: 220)
Name: NF5900_low_23
Description: NF5900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5900_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 22915541 - 22915342
Alignment:
| Q |
1 |
agctaattcacaataaatctgtatctaaataacatttgctaaaatttagctacagtatgtttcgtagttaatatccaattttcttgtagtcaaataaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22915541 |
agctaattcacaataaatctgtatctaaataacatttgctaaaatttagctaaaatatgtttcgtagttaatatccaattttctt---gtcaaataaata |
22915445 |
T |
 |
| Q |
101 |
aattatttcgttacataatttaatgaaattatttgtctttttctctaatattaattattattttggtctggacaagtcaaaatgacctttgacccattta |
200 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||| ||||||| ||| |||| | |||||| |
|
|
| T |
22915444 |
aattattttgttatataatttaatgaaattatttgtctttttctataatattaattattattttattcttgaccggtcaaaaggacatttggctcattta |
22915345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University