View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5900_low_3 (Length: 474)
Name: NF5900_low_3
Description: NF5900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5900_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 119 - 418
Target Start/End: Complemental strand, 31780965 - 31780666
Alignment:
| Q |
119 |
tgaaaccctaaatcggagagagaaagtgagagggaaaatagtgaaaggggttattaggggttttannnnnnnncagtttatttgaattttgcttatttgc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
31780965 |
tgaaaccctaaatcggagagagaaagtgagagggaaaatagtgaaaggggttattagggtttttattttttttcagtttatttgaattttgcttatttgc |
31780866 |
T |
 |
| Q |
219 |
gaaattttcccgctaaaattttgggtacacacggtgtggggtatctgacaggatcccaggtggtgtgacgtggctgtgtttgattggttggttttggtat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31780865 |
gaaattttcccgctaaaattttgggtacacacggtgtggggtatctgacaggatcccaggtggtgtgacgtggctgtgtttgattggttggttttggtat |
31780766 |
T |
 |
| Q |
319 |
ccgaggctgagtgggtccggtatgtcattgattggtgagattactgcgccatgagacacggcgtgaatttttattaattggggaaaattaaaaatggaga |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31780765 |
ccgaggctgagtgggtccggtatgtcattgattggtgagattactgcgccatgagacacggcgtgaatttttattaattggggaaaattaaaaatggaga |
31780666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University