View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5903_high_18 (Length: 230)
Name: NF5903_high_18
Description: NF5903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5903_high_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 80 - 220
Target Start/End: Complemental strand, 35018833 - 35018693
Alignment:
| Q |
80 |
cattatataataaaattttccattagaacttttgttagtaatagtataccattattactgagacatattaaagctaatgatgttgacttttggaagggtt |
179 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35018833 |
cattaaataataaaattttccatgagaacttttgttagtaatagtataccattattactgagacatattaaagctaatgatgttgacttttggaagggtt |
35018734 |
T |
|
| Q |
180 |
gtcatgttttttgaacctctcacggatcttgttttcctatg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35018733 |
gtcatgttttttgaacctctcacggatcttgttttcctatg |
35018693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 53 - 87
Target Start/End: Complemental strand, 35018874 - 35018840
Alignment:
| Q |
53 |
taaaatatgaatgaatatacttcatcacattatat |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35018874 |
taaaatatgaatgaatatacttcatcacattatat |
35018840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University