View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5903_high_8 (Length: 280)
Name: NF5903_high_8
Description: NF5903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5903_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 28436024 - 28435904
Alignment:
| Q |
1 |
tataaaatgttggataatatagagtaaaatagtgagttgaaaaatatatatatcagatgttttattaacattattcataagaataaaagagatatattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28436024 |
tataaaatgttggataatatagaggaaaatagtgtgttgaaaaatatatat--cagatgttttattaacattattcataagaataaaagagatatattgg |
28435927 |
T |
 |
| Q |
101 |
aaattgatttgatgagcacaaac |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28435926 |
aaattgatttgatgagcacaaac |
28435904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 279
Target Start/End: Complemental strand, 28435864 - 28435786
Alignment:
| Q |
201 |
ttcgaacctcagactttatatgtttttgctaactgagttaagacactattttgcgtacctaagagcgtagctttctctt |
279 |
Q |
| |
|
|||||||||||||| ||| |||| ||| |||||||||||||||| | ||||||||| ||| | |||||||||||||| |
|
|
| T |
28435864 |
ttcgaacctcagaccttacatgtccttgttaactgagttaagacattgttttgcgtaactagtaacgtagctttctctt |
28435786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University