View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5903_low_18 (Length: 232)

Name: NF5903_low_18
Description: NF5903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5903_low_18
NF5903_low_18
[»] chr3 (1 HSPs)
chr3 (76-205)||(7965947-7966077)


Alignment Details
Target: chr3 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 76 - 205
Target Start/End: Original strand, 7965947 - 7966077
Alignment:
76 atatgtttagagttaataaccttgaaattaacaaggttagctatggtgagtctagggatgaaggtgactgaaagggagtgcttgctttttt-aaataata 174  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
7965947 atatgtttagagttaataaccttgaaattaacaaggttaactatggtgagtctagggatgaaggtgactgaaagggagtgcttgcttttttaaaataata 7966046  T
175 aaaattaaagacaatataaacctcatatagt 205  Q
    ||||||||||||||||||||| |||||||||    
7966047 aaaattaaagacaatataaacttcatatagt 7966077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University