View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5903_low_18 (Length: 232)
Name: NF5903_low_18
Description: NF5903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5903_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 76 - 205
Target Start/End: Original strand, 7965947 - 7966077
Alignment:
| Q |
76 |
atatgtttagagttaataaccttgaaattaacaaggttagctatggtgagtctagggatgaaggtgactgaaagggagtgcttgctttttt-aaataata |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7965947 |
atatgtttagagttaataaccttgaaattaacaaggttaactatggtgagtctagggatgaaggtgactgaaagggagtgcttgcttttttaaaataata |
7966046 |
T |
 |
| Q |
175 |
aaaattaaagacaatataaacctcatatagt |
205 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |
|
|
| T |
7966047 |
aaaattaaagacaatataaacttcatatagt |
7966077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University