View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5904-Insertion-4 (Length: 238)
Name: NF5904-Insertion-4
Description: NF5904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5904-Insertion-4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 2e-60; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 10 - 147
Target Start/End: Complemental strand, 2618877 - 2618740
Alignment:
| Q |
10 |
tttttgcaggaaccaccaagtaatttgcccccattcttgcaaacaaagtcacacacttcatttagagttgggccaacacgtgaactagcgaagaaagaac |
109 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2618877 |
tttttgcaggaaccacctagtaatttgtccccattcttgcaaacaaagtcacacacttcacttagagttgggccaacacatgaactagcgaagaaagaac |
2618778 |
T |
|
| Q |
110 |
tctttttctcacaaccttcaatctgcaccacaggttct |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2618777 |
tctttttctcacaaccttcaatctgcaccacagtttct |
2618740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 106 - 147
Target Start/End: Complemental strand, 2624215 - 2624174
Alignment:
| Q |
106 |
gaactctttttctcacaaccttcaatctgcaccacaggttct |
147 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
2624215 |
gaactctttttctcacaaccttcaatcttcaccacagcttct |
2624174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 147
Target Start/End: Complemental strand, 2630525 - 2630449
Alignment:
| Q |
71 |
ttagagttgggccaacacgtgaactagcgaagaaagaactctttttctcacaaccttcaatctgcaccacaggttct |
147 |
Q |
| |
|
||||| |||||||||| | || || | ||||| || |||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
2630525 |
ttagaattgggccaacgcatggaccaacgaagtcaggactctttttctcacaaccttcaatttgcaccacagcttct |
2630449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University