View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5905-Insertion-13 (Length: 160)
Name: NF5905-Insertion-13
Description: NF5905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5905-Insertion-13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 5e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 9 - 160
Target Start/End: Complemental strand, 36561986 - 36561835
Alignment:
| Q |
9 |
aaaagaatgtgttggcccctataaaagcaggtcatggtaggctaagaatagcatgcaagaggacatagtagaaaaagacataggagaaaaagacagtaga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36561986 |
aaaagaatgtgttggcccctataaaagcaggtcatggtagactaagaatagcatgcaagaggacatagtacaaaaagacataggagaaaaagacagtaga |
36561887 |
T |
 |
| Q |
109 |
atcagttatatctggtttatagtattacttttgaaggtttgctccaagatta |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36561886 |
atcagttatatctggtttatagtattacttttgaaggtttgctccaagatta |
36561835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University