View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5905_high_31 (Length: 247)
Name: NF5905_high_31
Description: NF5905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5905_high_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 45166818 - 45166584
Alignment:
| Q |
1 |
tatttatcttggtaacgacttttatttatttgtctacgaccttattatcaacatgnnnnnnncaaaa-cnnnnnnnnncacaagagaatttctattatta |
99 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||| || ||||| | ||||| |||||||||||||||| |
|
|
| T |
45166818 |
tatttgtcttggtaacgacttttatttatttgtctaggaccttattatcaacctgtttttttcaaaaacaaaaagaaacacaaaagaatttctattatta |
45166719 |
T |
|
| Q |
100 |
attaaagtaacattaatgattattcgataaatgtttccgataagatttgagccatgcacgttaatattatagggttagacttttcccggtgaactaaaca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45166718 |
attaaagtaacattaatgattattcgataaatgtttccgataagatttgaaccatgcacgttaatattatagggttagacttttcccggtgaact-aaca |
45166620 |
T |
|
| Q |
200 |
taaataaaaggaagaat-gaaggattttgggaggga |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
45166619 |
taaataaaaggaagaatcaaaggattttggaaggga |
45166584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University