View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5905_high_34 (Length: 226)
Name: NF5905_high_34
Description: NF5905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5905_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 18 - 125
Target Start/End: Original strand, 48784944 - 48785049
Alignment:
| Q |
18 |
gtttcgatggttgttatagtttggttagcataattttggatcagttgatacattttacacgttacttaacaatagttatagtctaggtagtcatttgact |
117 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48784944 |
gtttcgatggttgttacaatttggttagcataattttggatcagttgata--ttttacacgttacttaacaatagttatagtctaggtagtcatttgact |
48785041 |
T |
 |
| Q |
118 |
ataaacag |
125 |
Q |
| |
|
|||||||| |
|
|
| T |
48785042 |
ataaacag |
48785049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University