View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5905_high_37 (Length: 220)
Name: NF5905_high_37
Description: NF5905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5905_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 30465331 - 30465521
Alignment:
| Q |
18 |
cacaaccaaatagcgctacagagagcggccagcagagctattaaaggccaactaaaaatcgcaattcaaactttgattcatcagattgtggaaatctaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30465331 |
cacaaccaaatagcgctacagagagcggccagcagagctattaaaggccaactaaaaatcgcaactcaaactttgattcatcagattgtggaaatctaac |
30465430 |
T |
 |
| Q |
118 |
atcttttgctagacttcaccccgttagtaaagtatgcatcacctttattcatcaaattgtta---tatgtacttgtaaacatagagaatta |
205 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30465431 |
atcttttgctagagttcaccccgttagtaaagtatgcatcacctttattcatcaaattgttatattatgtacttgtaaacatagagaatta |
30465521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University