View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5905_low_29 (Length: 248)
Name: NF5905_low_29
Description: NF5905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5905_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 11 - 123
Target Start/End: Original strand, 41302194 - 41302306
Alignment:
| Q |
11 |
aaagcaaaagtgaatgaagatgaaatattgtaaattggttatatccattagcttgcaattgtttacaaatgtcaaagattgagattgttacaacattcac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41302194 |
aaagcaaaagtgaatgaagatgaaatattgtaaattggttatatccattagcttgcaattgtttacaaatgtcaaagattgagattgttacaacattcac |
41302293 |
T |
 |
| Q |
111 |
cacaacgatttac |
123 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41302294 |
cacaacgatttac |
41302306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 192 - 233
Target Start/End: Original strand, 41302393 - 41302434
Alignment:
| Q |
192 |
actttgctgcaatctttaacgtacagatctcaccaacctggt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41302393 |
actttgctgcaatctttaacgtacagatctcaccaacctggt |
41302434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University