View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5906_low_2 (Length: 256)
Name: NF5906_low_2
Description: NF5906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5906_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 45781857 - 45781634
Alignment:
| Q |
18 |
ggtataatgcatcgtacattgaatgatgttaaggttactcttttatatgcatcgatgttgggttccatggagttatggacgtataatcgttgcaaagtgg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45781857 |
ggtataatgcatcgtacattgaatgatgttaaggttactcttttatatgcatcgatgttgggttccatggagttatggacgtata-tcgttgcaaagtgg |
45781759 |
T |
 |
| Q |
118 |
ttacagacggcgaggtcttgtaacctttggtcgttgctccttatgacggcacaaagcattacaaaaacaaagggtgtataaacgtcaatggggctcaaag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45781758 |
ttacagacggcgaggtcttgtaacctttggtcgttgctccttatgacggtacaaagcattacaaaaacaaagggtgtataaacatcaatggggctcaaag |
45781659 |
T |
 |
| Q |
218 |
atgtgcttaattaggccttcctctt |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45781658 |
atgtgcttaattaggccttcctctt |
45781634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University