View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5907-Insertion-23 (Length: 109)
Name: NF5907-Insertion-23
Description: NF5907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5907-Insertion-23 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 1e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 1e-50
Query Start/End: Original strand, 9 - 109
Target Start/End: Complemental strand, 30148917 - 30148817
Alignment:
| Q |
9 |
tatcactatgatccttctttaacaccaagttgcttcaaaacttggataagttcatccaactctttagaggaaactccacccttactcacagccccaacaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30148917 |
tatcactatgatccttctttaacaccaagttgcttcaaaacttggataagttcatccaactctttagaggaaactccacccttactcacagccccaacaa |
30148818 |
T |
 |
| Q |
109 |
c |
109 |
Q |
| |
|
| |
|
|
| T |
30148817 |
c |
30148817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 59; Significance: 2e-25; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 140715 - 140805
Alignment:
| Q |
12 |
cactatgatccttctttaacaccaagttgcttcaaaacttggataagttcatccaactctttagaggaaactccacccttactcacagccc |
102 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||| | |||| |||||||| |||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
140715 |
cactatgatctttctttaacaccaagttgctgcaaagcatggacaagttcattcaactctttagaggaaacaccatccttactcacagccc |
140805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University