View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5907_high_25 (Length: 356)
Name: NF5907_high_25
Description: NF5907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5907_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 18 - 347
Target Start/End: Original strand, 6221455 - 6221784
Alignment:
| Q |
18 |
tgttctagcttaaaaaacaaaaggaacaaaattttaatttgaccgaacaaaacaccaagcatcggattctgaccaatctaacggtctttcatttgtgact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6221455 |
tgttctagcttaaaaaacaaaaggaacaaaattttaatttgaccgaacaaaacaccaagcatcggattctgaccaatctaacggtctttcatttgtgact |
6221554 |
T |
|
| Q |
118 |
agtcgttgaagcctctcgcccggtgaacaaaaaccttgctcaaatttcagttcacatacttcctttgcatcaggaggcaaagtcgtaacactagaagaag |
217 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6221555 |
agtcgttgaagactctcgcccggtgaacaaaaaccttgctcaaatttcagttcacatacttcctttgcatcaggaggcaaagtcgtaacactagaagaag |
6221654 |
T |
|
| Q |
218 |
cccaatgaggaaaatcgaagtgagttctcggagatggtgatattgacaatggcaactcattcatcaactctttcaccaatgaaacagtttcatcacctga |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6221655 |
cccaatgaggaaaatcgaagtgagttctcggagatggtgatattgacaatggcaactcattgatcaactctttcaccaatgaaacagtttcatcacctga |
6221754 |
T |
|
| Q |
318 |
gataaactcatgtttcaaaagcatctctgc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6221755 |
gataaactcatgtttcaaaagcatctctgc |
6221784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University