View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5907_high_34 (Length: 331)
Name: NF5907_high_34
Description: NF5907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5907_high_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 3e-39; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 21 - 103
Target Start/End: Original strand, 27896757 - 27896839
Alignment:
| Q |
21 |
aatggttcaacaaaaatatacgcgttaaattgattacctgaacaaaagattgaattgaaagttatcgtgcaactataactcat |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27896757 |
aatggttcaacaaaaatatacgcgttaaattgattacctgaacaaaagattgaattgaaagttatcgtgcaactataactcat |
27896839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 232 - 310
Target Start/End: Original strand, 27897729 - 27897807
Alignment:
| Q |
232 |
actatgtaattttagaccattatgttggactcaagcctagcttatactactataacccctttattaatatggttttctt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27897729 |
actatgtaattttagaccattatgttggactcaagcctagcttatactactataacccctttattaatatggttttctt |
27897807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 181 - 236
Target Start/End: Original strand, 27897447 - 27897502
Alignment:
| Q |
181 |
ggacattacatgtgaatattgtttttatatgttttaatcaatttttgattcactat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
27897447 |
ggacattacatgtgaatattgtttttatatgtctgaatcaatttttgattcactat |
27897502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University