View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5907_high_47 (Length: 288)
Name: NF5907_high_47
Description: NF5907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5907_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 17 - 280
Target Start/End: Original strand, 23888259 - 23888522
Alignment:
| Q |
17 |
agaatattgagtgatatgctcttaaggcaggaggatctatctatggctcttgcattagccagcacatggaccatgttcattgcatttggaagtttagtgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23888259 |
agaatattgagtgatatgctcttaaggcaggaggatctatctatggctcttgcattagccagcacatggaccatgttcattgcatttggaagtttagtgt |
23888358 |
T |
 |
| Q |
117 |
gtattgggccaatatcttataccgttggcatggcttatcaaaatgccttcagttcaggtttatcatatatatagtagccagccagctgcattcgggtttc |
216 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23888359 |
gtattgggccaatatcttacaccgttggcatggcttatcaaaatgccttcagttcaggtttatcatatatatagtagccagccagctgcattcgggtttc |
23888458 |
T |
 |
| Q |
217 |
tggcctcggtgaatagcattatgttcattgtgttgtgtcagcttcaggtaaaaatctctctgct |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23888459 |
tggcctcggtgaatagcattatgttcattgtgttgtgtcagcttcaggtaaaaatctctctgct |
23888522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University