View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5907_high_51 (Length: 272)
Name: NF5907_high_51
Description: NF5907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5907_high_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 257
Target Start/End: Original strand, 40383908 - 40384149
Alignment:
| Q |
16 |
atgattggatcgtggatgatgtctgtgccgatggagacacggcggcgttctccaccggaaacaccacggtgaccttcatctccgatgacagttgaggcag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383908 |
atgattggatcgtggatgatgtctgtgccgatggagacacggcggcgttctccaccggaaacaccacggtgaccttcatctccgatgacagttgaggcag |
40384007 |
T |
 |
| Q |
116 |
cgttgcggagaccgagctggtcgatgagtgcttggacacgagcttttttctttgatttggagagagagcgagggagacgaaactcagcagagaacatgag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40384008 |
cgttgcggagaccgagctggtcgatgagtgcttggacacgagcttttttctttgatttggagagagagcgagggagacgaaactcagcagagaacatgag |
40384107 |
T |
 |
| Q |
216 |
agtttcttccacggtgagcatggggaagagaagatcgtcttg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40384108 |
agtttcttccacggtgagcatggggaagagaagatcgtcttg |
40384149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 63 - 257
Target Start/End: Complemental strand, 52375198 - 52375004
Alignment:
| Q |
63 |
ttctccaccggaaacaccacggtgaccttcatctccgatgacagttgaggcagcgttgcggagaccgagctggtcgatgagtgcttggacacgagctttt |
162 |
Q |
| |
|
||||||||| || || |||||||||||||| |||||||| || ||| || ||||||||||| || || || || || | ||||| |||||||| ||| |
|
|
| T |
52375198 |
ttctccaccagagactccacggtgaccttcgtctccgataactgttttcgctgcgttgcggagtcctagttgatcaatcaaagcttgaacacgagcgttt |
52375099 |
T |
 |
| Q |
163 |
ttctttgatttggagagagagcgagggagacgaaactcagcagagaacatgagagtttcttccacggtgagcatggggaagagaagatcgtcttg |
257 |
Q |
| |
|
||||||||||| ||||| || || || | || || ||||| | || ||||||||||||| || |||||||| || ||||| ||||| ||||| |
|
|
| T |
52375098 |
ttctttgattttgagagtgatcgcggtaatcggaattcagctgcaaaggtgagagtttcttcaactgtgagcattggaaagaggagatcatcttg |
52375004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University