View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5907_low_20 (Length: 416)
Name: NF5907_low_20
Description: NF5907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5907_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 276
Target Start/End: Original strand, 17473574 - 17473834
Alignment:
| Q |
18 |
ttttccagcttcgagatgctcttgcttccgcacctgagccgacgccatttgagaaaagcggaggatctagaagagatttttgaaatcaacgaattcaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17473574 |
ttttccagcttcgagatgctcttgcttccgcacctgagccgacgccatttgagaaaagcggaggatctagaagagatttttgaaatcaacgaattcaaaa |
17473673 |
T |
|
| Q |
118 |
tctcaatgcataaatcaccattcacgttgcaatgaatccgaattgaagaaatttgaagagaatttccaagatcgcagaatcaatttg--aaaattgaaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
17473674 |
tctcaatgcataaatcaccattcacgttgcaatgaatccgaattgaagaaatttgaagagaatttccaagatcgcagaatcaatttgataaatttgaaaa |
17473773 |
T |
|
| Q |
216 |
ttgaaacgttaaaaggagaatcgaaagtgttggaattcagacagaagtacccgatctgatc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17473774 |
ttgaaacgttaaaaggagaatcgaaagtgttggaattcagacagaagtgcccgatctgatc |
17473834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 289 - 325
Target Start/End: Original strand, 17473871 - 17473907
Alignment:
| Q |
289 |
tgcagatttctctctcttcttggttctggttttgggg |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17473871 |
tgcagatttctctctcttcttggttctggttttgggg |
17473907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University