View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5907_low_32 (Length: 336)
Name: NF5907_low_32
Description: NF5907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5907_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 21 - 278
Target Start/End: Original strand, 13213960 - 13214217
Alignment:
| Q |
21 |
attaatatatgtctttcactaatagggtaaaaaaccttactcactatcttaattcttaaaccttggtctttactactgcctctttctctcagctatatgc |
120 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13213960 |
attaatatatgtcttacactaatagggtaaaaaaccttactcactatcttaattcttaaaccttggtctttactactgcctctttctctcagctatatgc |
13214059 |
T |
 |
| Q |
121 |
accttcttttcagacaaccacctctatctctatgtctttggaactcattattgcttcctctgatggttcctagaattggtatgcttcaaagttcagctat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13214060 |
accttcttttcagacaaccacctctatctctatgtctttggaactcattattgcttcctctgatggttcctagaattggtatgcttcaaagttcagctat |
13214159 |
T |
 |
| Q |
221 |
atcccgtgcaaaagatcactttcttcctacttaaaaatgttcaaaccttcttcacaaa |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13214160 |
atcccgtgcaaaagatcactttcttcctacttaaaaatgttcaaaccttcttcacaaa |
13214217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 292 - 327
Target Start/End: Original strand, 13214233 - 13214268
Alignment:
| Q |
292 |
cttaatgatcaaaccttcctgtgtttttagtataat |
327 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13214233 |
cttaatgttcaaaccttcctgtgtttttagtataat |
13214268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University