View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5907_low_48 (Length: 281)
Name: NF5907_low_48
Description: NF5907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5907_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 178 - 220
Target Start/End: Original strand, 41033649 - 41033691
Alignment:
| Q |
178 |
aatatatgattttttgacaacttgttacttaaatacatgtcga |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41033649 |
aatatatgattttttgacaacttgttacttaaatatatgtcga |
41033691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 41033611 - 41033652
Alignment:
| Q |
1 |
aacgtagagatataaataaagaagtatgagtgtttatgaata |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
41033611 |
aacgtagagatataaataaagaagtatgagtcttaatgaata |
41033652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 131 - 184
Target Start/End: Complemental strand, 43616109 - 43616056
Alignment:
| Q |
131 |
actactaattattttatttttcctccttcgagtttttagttcctctaaatatat |
184 |
Q |
| |
|
|||| |||||||| | ||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
43616109 |
actattaattattatttttttcctcttttgagtttttagttcctctaaatatat |
43616056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University