View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5907_low_52 (Length: 271)
Name: NF5907_low_52
Description: NF5907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5907_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 20 - 264
Target Start/End: Original strand, 3229028 - 3229272
Alignment:
| Q |
20 |
caatacacacctgcatactagcatgtccaatatccacaaaagctacattcagctgatcattctctggcagatctgtcttataaatcccatacgccaatgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3229028 |
caatacacacctgcatactagcatgtccaatatccacaaaagctacattcagctgatcattctctggcagatctgtcttataaatcccatacgccaatgc |
3229127 |
T |
|
| Q |
120 |
agttgcagtagtttcatgaagcaaccgaagcggatgcaaaccagcaatagttgcagcatccaacacagcccttctctgtagatcagtaaaataacacgga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3229128 |
agttgcagtagtttcatgaagcaaccgaagcggatgcaaaccagcaatagttgcagcatccaacacagcccttctctgtagatcagtaaaataacacgga |
3229227 |
T |
|
| Q |
220 |
atcccaatacaacaatcattaaccgcagcattaagattcttctca |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3229228 |
atcccaatacaacaatcattaaccgcagcattaagattcttctca |
3229272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 31 - 209
Target Start/End: Complemental strand, 43970790 - 43970612
Alignment:
| Q |
31 |
tgcatactagcatgtccaatatccacaaaagctacattcagctgatcattctctggcagatctgtcttataaatcccatacgccaatgcagttgcagtag |
130 |
Q |
| |
|
||||| |||||||| |||| ||| || || || ||||||||| ||||| || || ||||| ||||||||||| ||||| ||||| |||||||| || | |
|
|
| T |
43970790 |
tgcatgctagcatgcccaacatcaacgaaggcaacattcagccattcattttccggaagatcagtcttataaattccataagccaaggcagttgctgttg |
43970691 |
T |
|
| Q |
131 |
tttcatgaagcaaccgaagcggatgcaaaccagcaatagttgcagcatccaacacagcccttctctgtagatcagtaaa |
209 |
Q |
| |
|
| ||||||| ||| ||||||| |||||||| |||||||| || |||||||| |||| || ||||| ||||| ||||| |
|
|
| T |
43970690 |
tctcatgaatcaagtgaagcgggtgcaaacctgcaatagtggctgcatccaatacagatctcctctgaagatcggtaaa |
43970612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University