View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5907_low_66 (Length: 249)

Name: NF5907_low_66
Description: NF5907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5907_low_66
NF5907_low_66
[»] chr8 (2 HSPs)
chr8 (1-66)||(43016495-43016560)
chr8 (128-163)||(43016398-43016433)


Alignment Details
Target: chr8 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 43016560 - 43016495
Alignment:
1 tacatacctgaaaattttcattttgttggagcatgattgttgaaacatggtaagaattgtcatcaa 66  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43016560 tacatacctgaaaattttcattttgttggagcatgattgttgaaacatggtaagaattgtcatcaa 43016495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 163
Target Start/End: Complemental strand, 43016433 - 43016398
Alignment:
128 aggcctacttatatggaaagctgcgtttgcactaat 163  Q
    ||||||||||||||||||||||||||||||||||||    
43016433 aggcctacttatatggaaagctgcgtttgcactaat 43016398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University