View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5907_low_83 (Length: 210)
Name: NF5907_low_83
Description: NF5907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5907_low_83 |
 | |
|
| [»] scaffold0393 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0393 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: scaffold0393
Description:
Target: scaffold0393; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 9907 - 9747
Alignment:
| Q |
1 |
cacttctgttccgatcatccgactaattagtccacgacttgtgtcatgcttatgattcctgcaatgataaatcttcatctagacctcataatttcttcct |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9907 |
cacttctgttccgatcatccgactcattagtccacgacttgtgtcatgcttatgattcctgcaatgataaatcttcatctagacctcataatttcttcct |
9808 |
T |
|
| Q |
101 |
tgctctgcgtaaatggtatccgtcccttaagccagagatggagtttcggtgttttgtgcgg |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9807 |
tgctctgcgtaaatggtatccgtcccttaagccagagatggagtttcggtgttttgtgcgg |
9747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0393; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 203
Target Start/End: Complemental strand, 9142 - 9105
Alignment:
| Q |
166 |
ctaatatttgacattgcttcatgccttcagtattattt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9142 |
ctaatatttgacattgcttcatgccttcagtgttattt |
9105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 2407350 - 2407190
Alignment:
| Q |
1 |
cacttctgttccgatcatccgactaattagtccacgacttgtgtcatgcttatgattcctgcaatgataaatcttcatctagacctcataatttcttcct |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2407350 |
cacttctgttccgatcatccgactcattagtccacgacttgtgtcatgcttatgattcctgcgatgataaatcttcatctagacctcataatttcttcct |
2407251 |
T |
|
| Q |
101 |
tgctctgcgtaaatggtatccgtcccttaagccagagatggagtttcggtgttttgtgcgg |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2407250 |
tgctctgcgtaaatggtatccgtcccttaagccagagatggagtttcggtgttttgtgcgg |
2407190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 203
Target Start/End: Complemental strand, 2406588 - 2406551
Alignment:
| Q |
166 |
ctaatatttgacattgcttcatgccttcagtattattt |
203 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
2406588 |
ctaatatttggcattgcttcatgccttcagtgttattt |
2406551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 21478295 - 21478145
Alignment:
| Q |
7 |
tgttccgatcatccgactaattagtccacgacttgtgtcatgcttatgattcctgcaatgataaatcttcatctagacctcataatttcttccttgctct |
106 |
Q |
| |
|
|||||||| ||||||||| ||||||||| |||||||| |||||||||||||| ||| | |||||| | ||||| |||| || |||||||| |||||||| |
|
|
| T |
21478295 |
tgttccgagcatccgactcattagtccatgacttgtgccatgcttatgattcttgccacgataaaattacatctcgaccccagaatttctttcttgctct |
21478196 |
T |
|
| Q |
107 |
gcgtaaatggtatccgtcccttaagccagagatggagtttcggtgttttgt |
157 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||| |||||||| |
|
|
| T |
21478195 |
ccgtaaatggtatccatcccttaagccagacatggagtttcgttgttttgt |
21478145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 30598060 - 30597905
Alignment:
| Q |
1 |
cacttctgttccgatcatccgactaattagtccacgacttgtgtc--atgcttatgattcctgcaatgataaatcttcatctagacctcataatttcttc |
98 |
Q |
| |
|
||||||| |||| | ||||| ||| ||||||||| |||||||| | ||||| |||| || ||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
30598060 |
cacttcttttccaagcatccaactcattagtccatgacttgtgccttatgctaatgactcttgccatgataaatcttcatctagaccgcataatttcttc |
30597961 |
T |
|
| Q |
99 |
cttgctctgcgtaa--------atggtatccgtcccttaagccagagatggagttt |
146 |
Q |
| |
|
||| | | ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30597960 |
cttattatacgtaaatgataatatggtatccgtcccttaagccagagatggagttt |
30597905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 203
Target Start/End: Original strand, 15084173 - 15084210
Alignment:
| Q |
166 |
ctaatatttgacattgcttcatgccttcagtattattt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15084173 |
ctaatatttgacattgcttcatgccttcagtgttattt |
15084210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University