View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5907_low_84 (Length: 203)
Name: NF5907_low_84
Description: NF5907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5907_low_84 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 7e-85; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 12 - 186
Target Start/End: Complemental strand, 12339429 - 12339256
Alignment:
| Q |
12 |
caaaggagaacaaatgttgccctattccaccagctgtgaaactgagagacgtagataacataacagaggaggcattgattactacaataagaaagagcaa |
111 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12339429 |
caaaggagaataaatgttgccccattccaccagctgtgaaactgagagacgtagataacataacagaggaggcattgattactacaataag-aagagcaa |
12339331 |
T |
 |
| Q |
112 |
ttagtttctcttcctcaattcaagctcatgatgggcactggcctgcggaatgtgctggttcattgctttcgattc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12339330 |
ttagtttctcttcctcaattcaagctcatgatgggcactggcctgcggaatgtgctggttcattgctttcgattc |
12339256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 24 - 169
Target Start/End: Complemental strand, 35186202 - 35186058
Alignment:
| Q |
24 |
aatgttgccctattccaccagctgtgaaactgagagacgtagataacataacagaggaggcattgattactacaataagaaagagcaattagtttctctt |
123 |
Q |
| |
|
||||| |||| ||||||||||| || ||||||||||| | ||||| |||||||| ||| |||||||| || ||||| | |||| || || ||||||| || |
|
|
| T |
35186202 |
aatgtagccccattccaccagcagttaaactgagagaagaagatatcataacaggggaagcattgataacaacaatta-aaagggctataagtttctatt |
35186104 |
T |
 |
| Q |
124 |
cctcaattcaagctcatgatgggcactggcctgcggaatgtgctgg |
169 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||| |||||| |
|
|
| T |
35186103 |
cctcaattcaagctcatgatggccactggcctgcagaatctgctgg |
35186058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University