View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5908_low_12 (Length: 250)
Name: NF5908_low_12
Description: NF5908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5908_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 113 - 246
Target Start/End: Original strand, 47990338 - 47990471
Alignment:
| Q |
113 |
atagattcatgggagtggttaaagttgggtccaagcaaaacacgggcttaaataacccatggactttttatacgggctgactttgggccaagtggtggac |
212 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47990338 |
ataggttcatgggagtagttaaagttgggtccaagcaaaacacgggcttaaataacccatggactttttatacgggctgactttgggccaagtggtggac |
47990437 |
T |
|
| Q |
213 |
ggtttcccgccataatcctgcaaatgcaacgcaa |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47990438 |
ggtttcccgccataatcctgcaaatgcaacgcaa |
47990471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University