View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5909-Insertion-6 (Length: 423)
Name: NF5909-Insertion-6
Description: NF5909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5909-Insertion-6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 50 - 416
Target Start/End: Complemental strand, 44563909 - 44563542
Alignment:
| Q |
50 |
aatatgatactcatacaattagcttcatttccaagcattattttattcattatacttgcttctttagatttgcttcttccattatccaatactattattt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44563909 |
aatatgatactcatacaattagcttcatttccaagcattattttattcattatacttgcttctttagatttgcttcttccattatccaatactattattt |
44563810 |
T |
 |
| Q |
150 |
aatatactttgttatttcatttctcctatacta-nnnnnnnataatttcatcataaaattccagtaattgttggatctcataagtaacatatttagattc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44563809 |
aatatactttgttatttcatttctcctatactattttttttataatttcatcataaaattccagtaattgttggatctcataagtaacatatttagattc |
44563710 |
T |
 |
| Q |
249 |
gtgttgttggatttgtgatttttcaaactattgttattcactttactctctaaaaatctcacctattgnnnnnnnnnnnnnggattgcatcaaactcaat |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
44563709 |
gtgttgttggatttgtgatttttcaaactattattattcactttactctctaaaaatctcacctactgttttttcttttttggattgcatcaaactcaat |
44563610 |
T |
 |
| Q |
349 |
aactcagattgggtttatttatgtaagtaaattattgatttttatgttgttgttctcttgttcttgtt |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44563609 |
aactcagattgggtttatttatgtaagtaaattattgatttttatgttgttgttctcttgttcttgtt |
44563542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 330 - 397
Target Start/End: Complemental strand, 7691217 - 7691150
Alignment:
| Q |
330 |
ggattgcatcaaactcaataactcagattgggtttatttatgtaagtaaattattgatttttatgttg |
397 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||||||| ||| | | ||||||||| |||||| |
|
|
| T |
7691217 |
ggattccatcatactcaatagctcagattgggtttatttatgtgagttagtaattgattttgatgttg |
7691150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University