View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5909_low_1 (Length: 355)
Name: NF5909_low_1
Description: NF5909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5909_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 13 - 131
Target Start/End: Original strand, 6278173 - 6278291
Alignment:
| Q |
13 |
aagcataggaagaagcgaatgtgtgggacatatcaattcctcccccacctgataacaaaattttaaatttatatgccactcatagatgaattttttaggc |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||| | |
|
|
| T |
6278173 |
aagcataggaagaagtgaatgtgtgggacatatcaattcctcccccacgtgataacaaaattttaaatttatatatcactcatatatgaattttttagac |
6278272 |
T |
|
| Q |
113 |
tttgtttgagtatttgaaa |
131 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
6278273 |
tttatttgagtatttgaaa |
6278291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 165 - 289
Target Start/End: Original strand, 6278400 - 6278523
Alignment:
| Q |
165 |
attatttttgtagagaataataaattttattcccctaatcagaagaaatttttattatgnnnnnnnntgaattctctagaaccattctttctcaaagttc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
6278400 |
attatttttgtagagaataataaattttattccc-taatcagacgaaatttttattatgaagaaaaatgaattctctggaaccattctttttcaaagttc |
6278498 |
T |
|
| Q |
265 |
tcaatttttttcacttgcttcttcc |
289 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6278499 |
tcaatttttttcacttgcttcttcc |
6278523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University