View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5910_high_12 (Length: 307)
Name: NF5910_high_12
Description: NF5910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5910_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 301
Target Start/End: Original strand, 14393362 - 14393644
Alignment:
| Q |
20 |
ataacgtgctaggttggattagtattaagttgtctgtgcagtttgctttcagaaattccttgcacgaacaaacacatgagaacaaattttctgaactttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14393362 |
ataacgtgctaggttggattagtattaaattatctgtgcagtttgctttcagaaattccttgcacgaacaaacacatgagaacaaattttctgaactttg |
14393461 |
T |
|
| Q |
120 |
actgtttgaatttgaccatatccttccctatttgttaaaccattttttatttattttacagagatcaaaaataatttaataaaaaagattagaatcatat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
14393462 |
actgtttgaatttgaccatatccttccctatttgttaaaccattttttatttattttgcagagataaaaaataatttaataaaagagattagaatcatat |
14393561 |
T |
|
| Q |
220 |
agnnnnnnncaataattttggggcgaa-ttagttaaagaatatttgtcagcaaactctccaataaccctgtaatattcttgga |
301 |
Q |
| |
|
|| ||||||||| | ||||| ||||||||| |||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
14393562 |
agaaaaaaataataattttagtgcgaatttagttaaataatatttgtcggcaaactctccaataaccctgtaatattattgga |
14393644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University