View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5910_high_18 (Length: 222)
Name: NF5910_high_18
Description: NF5910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5910_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 51023280 - 51023461
Alignment:
| Q |
19 |
gagactgttaccaatgatgaaattgctgctgatctcaaagagcatgttatcaagcccgtgattcctgacaagtaccttgattccaagaccatttttcact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51023280 |
gagactgttaccaatgatgaaattgctgctgatctcaaagagcatgttatcaagcccgtgattcctgacaagtaccttgattccaagaccatttttcact |
51023379 |
T |
|
| Q |
119 |
tgaacccttctggccgttttgtcattggaggtcctcacggtgatgctggtctcactggtaggaagatcattattgacactta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51023380 |
tgaacccttctggccgttttgtcattggaggtcctcacggtgatgctggtctcactggtaggaagatcatcattgacactta |
51023461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 22 - 170
Target Start/End: Complemental strand, 20525643 - 20525495
Alignment:
| Q |
22 |
actgttaccaatgatgaaattgctgctgatctcaaagagcatgttatcaagcccgtgattcctgacaagtaccttgattccaagaccatttttcacttga |
121 |
Q |
| |
|
||||| |||||||| |||||||| |||||| | || || ||||| |||||||||||||| || || |||||||||||| || ||||| || ||||||| |
|
|
| T |
20525643 |
actgtcaccaatgacgaaattgcagctgatttgaaggaacatgtgatcaagcccgtgatcccagagaagtaccttgatgagaaaaccatcttccacttga |
20525544 |
T |
|
| Q |
122 |
acccttctggccgttttgtcattggaggtcctcacggtgatgctggtct |
170 |
Q |
| |
|
||||||| |||||||| ||||| || |||||||||||||| |||||||| |
|
|
| T |
20525543 |
acccttcaggccgtttcgtcatcggtggtcctcacggtgacgctggtct |
20525495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 40 - 200
Target Start/End: Original strand, 45208297 - 45208457
Alignment:
| Q |
40 |
attgctgctgatctcaaagagcatgttatcaagcccgtgattcctgacaagtaccttgattccaagaccatttttcacttgaacccttctggccgttttg |
139 |
Q |
| |
|
|||||||||||||| || || |||||||||||||| || ||||| || |||||| | ||| ||||| || || ||| | ||||||||||| || |||| |
|
|
| T |
45208297 |
attgctgctgatcttaaggaacatgttatcaagcctgttattcccgagaagtacttggatgagaagacaatcttccaccttaacccttctggacgctttg |
45208396 |
T |
|
| Q |
140 |
tcattggaggtcctcacggtgatgctggtctcactggtaggaagatcattattgacactta |
200 |
Q |
| |
|
||||||| ||||| || |||||||| |||||||| || || ||||| || ||||| ||||| |
|
|
| T |
45208397 |
tcattggtggtccccatggtgatgccggtctcaccggaagaaagattataattgatactta |
45208457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 197
Target Start/End: Original strand, 41213484 - 41213554
Alignment:
| Q |
127 |
tctggccgttttgtcattggaggtcctcacggtgatgctggtctcactggtaggaagatcattattgacac |
197 |
Q |
| |
|
||||| || ||||| ||||| || ||||| || ||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
41213484 |
tctggtcggtttgttattggtggacctcatggagatgcaggactcactggtaggaagatcattattgacac |
41213554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University