View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5910_low_10 (Length: 351)
Name: NF5910_low_10
Description: NF5910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5910_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 209 - 340
Target Start/End: Original strand, 39511254 - 39511384
Alignment:
| Q |
209 |
ccaaaacataacgcaaaattcaaacacgaatttagttttgaagttttagtcataagaaagcaagaattataactacaacgcaaatctaaacacaaatttg |
308 |
Q |
| |
|
|||||| | |||||||||||||||||| |||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39511254 |
ccaaaatagaacgcaaaattcaaacacaaatttaattt-gaagttttagtcataaaaaagcaagaattataactacaacgcaaatctaaacacaaatttg |
39511352 |
T |
|
| Q |
309 |
gaatccctactataagaagatcttgtattcat |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39511353 |
aaatccctactataagaagatcttgtattcat |
39511384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 22 - 185
Target Start/End: Original strand, 39511031 - 39511195
Alignment:
| Q |
22 |
tagctctccaaaattctcttctctaaaaatgaannnnnnnnaaataagaaaactctacgcacacatttggaaca----ggtatgaatccctcttaaccca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
39511031 |
tagctctccaaaattctcttctctaaaaattaaatttttt-agataagaaaactctacgcacacatttggaacaagtaggtatgaatccctctcaaccca |
39511129 |
T |
|
| Q |
118 |
catgcatcataagcgtgagcttacatatgaaaccatggtgtgagtcccttcgaatatgcaacgatcaa |
185 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||| |||| |||||||||| ||||||| ||||| |
|
|
| T |
39511130 |
catgcgtcataagcgcgagcttacatatgaaaccatg--gtgaatcccttcgaacatgcaaccatcaa |
39511195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University