View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5910_low_12 (Length: 310)
Name: NF5910_low_12
Description: NF5910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5910_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 77 - 282
Target Start/End: Original strand, 27879208 - 27879410
Alignment:
| Q |
77 |
tgtgtaacttaaatagtgtgtccaaatacttgtgactaaacaagacttgttctctttttacttattgtcctttattatttacacctatctataaataaaa |
176 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27879208 |
tgtgtaacttaaatagtatgtccaaatacttgtgactaaacatga-ttgttctctttttacttattgtcctttattatttacacct--ctataaataaaa |
27879304 |
T |
 |
| Q |
177 |
aaccttagcacaagagaagaaatgcaaaactattaggatcggatgctattaagactttatttaaaagctcaataaatatataaaaagattcttctcttgt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27879305 |
aaccttagcacaagagaagaaatgcaaaactattaggatcggatgctattaagactttatttaaaagctcaataaatatataaaaagattcttctcttgt |
27879404 |
T |
 |
| Q |
277 |
atttaa |
282 |
Q |
| |
|
|||||| |
|
|
| T |
27879405 |
atttaa |
27879410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University