View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5910_low_22 (Length: 217)
Name: NF5910_low_22
Description: NF5910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5910_low_22 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 45 - 217
Target Start/End: Original strand, 47990512 - 47990684
Alignment:
| Q |
45 |
gaaattgaattggtacaaatgttgcaaaccctagtagttcccgcaaggtttcgcttcgcaaatcgaatatctctccgtcgaagcttgagcagaattcgtt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47990512 |
gaaattgaattggtacaaatgttgcaaaccctagtagttcccgcaaggtttcgcttcgcaaatcgaatatctctccgtcgaagcttgagcagaattcgtt |
47990611 |
T |
 |
| Q |
145 |
cattcaattccgattatggagatcagtctcgtggtgggctccctcgattctactctgaaattcttcctccttc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47990612 |
cattcaattccgattatggagatcagtctcgtggtgggctccctcgattctactctgaaattcttcctccttc |
47990684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University