View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5910_low_7 (Length: 377)

Name: NF5910_low_7
Description: NF5910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5910_low_7
NF5910_low_7
[»] chr4 (1 HSPs)
chr4 (11-47)||(52647834-52647870)


Alignment Details
Target: chr4 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 11 - 47
Target Start/End: Complemental strand, 52647870 - 52647834
Alignment:
11 cagagaaaagctatataagcgaagttacaaactgtgt 47  Q
    |||||||||||||||||||||||||||||||||||||    
52647870 cagagaaaagctatataagcgaagttacaaactgtgt 52647834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University