View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5911-Insertion-13 (Length: 266)
Name: NF5911-Insertion-13
Description: NF5911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5911-Insertion-13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 42 - 145
Target Start/End: Complemental strand, 17500415 - 17500313
Alignment:
| Q |
42 |
gaaaccaacaacctattactaagtaagttagtttaaatactatttttcaagttaacataaattgaaaaaatgtttcagcaatgggttgatttacttggaa |
141 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17500415 |
gaaaccaacaaccttaaactaagtaagttagtttaaatactatttttcaagtcaacgtaaattga-aaaatgtttcagcaatgggttgatttacttggaa |
17500317 |
T |
 |
| Q |
142 |
cctt |
145 |
Q |
| |
|
|||| |
|
|
| T |
17500316 |
cctt |
17500313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 212 - 266
Target Start/End: Complemental strand, 17500297 - 17500243
Alignment:
| Q |
212 |
tcaatataatggtaaccatttttatttttaaaatgttgtatactagacactacaa |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17500297 |
tcaatataatggtaaccatttttatttttaaaatgttgtataatagacactacaa |
17500243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University