View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5911-Insertion-14 (Length: 129)
Name: NF5911-Insertion-14
Description: NF5911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5911-Insertion-14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 20 - 129
Target Start/End: Complemental strand, 7199348 - 7199239
Alignment:
| Q |
20 |
atattcatagatatagcatatggaaaaataatgtatacttacaatctgcatctgttttgatccaatgctctctgtaagaagatggatcttcttctggatg |
119 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7199348 |
atattcatagacatagcatatgaaaaaataatgtatacttacaatctgcatctgttttgatccaatgctctctgtaagaagatggatcttcttctggatg |
7199249 |
T |
 |
| Q |
120 |
cacaaggtag |
129 |
Q |
| |
|
|||||||||| |
|
|
| T |
7199248 |
cacaaggtag |
7199239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University