View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5911-Insertion-6 (Length: 546)
Name: NF5911-Insertion-6
Description: NF5911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5911-Insertion-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 9 - 330
Target Start/End: Complemental strand, 51725718 - 51725397
Alignment:
| Q |
9 |
aaaatctcatataatattcattgtaagtagaagagacgcgacattagagtaaaatgattgtaaactcttacgaacttgtctttagccctacaccaaataa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51725718 |
aaaatctcatataatattcattgtaagtagaagagacgcgacattagagtaaaatgattgtaaactcttacgaacttgtctttagccctacaccaaataa |
51725619 |
T |
|
| Q |
109 |
gtaaatcaaaatnnnnnnnctttgacctaatatttgttttcttttttnnnnnnncataccaaatattttccaatgtttattttctttgtttccctctctt |
208 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
51725618 |
gtaaatcaaaataaaaaaactttgacctaatatttgttttctttttaaaaaaaacataccaaatattttccaatgtttattttctttgtttccctcactt |
51725519 |
T |
|
| Q |
209 |
cagcctatatgttttttctgtcggttcatctcccctttgctctaaatttttactcatatttatactnnnnnnntatggttaagatatgagcaaaccaaaa |
308 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
51725518 |
cagcctatatgttttttctttcggttcatctcccctttgctctacatttttactcatatttatactaaaaaaatatggttaagatatgagcaaaccaaaa |
51725419 |
T |
|
| Q |
309 |
ttgcgggagatacaattgtagt |
330 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
51725418 |
ttgcaggagatacaattgtagt |
51725397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 403
Target Start/End: Complemental strand, 51729009 - 51728947
Alignment:
| Q |
342 |
tgtagtgatcctcgcaactggttttgatggaatgaaaaaggtc-aaaccaatttaccagagcc |
403 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| ||||||| || |||||| |||||||||||| |
|
|
| T |
51729009 |
tgtagtgatccttgcaactggttttaatggaaagaaaaagatcaaaaccattttaccagagcc |
51728947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University