View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5911_high_30 (Length: 261)
Name: NF5911_high_30
Description: NF5911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5911_high_30 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 14 - 261
Target Start/End: Original strand, 43451860 - 43452107
Alignment:
| Q |
14 |
aggccactgttgatgggatgattggcgagttacgctgtgcaatcaataacctgtacatgtcagagattctccaggaatctgaaatggcggctcttcaaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43451860 |
aggccactgttgatgggatgattggcgagttacgctgtgcaatcaataacctgtacatgtcagagattctccaggaatctgaaatggcggctcttcaaat |
43451959 |
T |
|
| Q |
114 |
agagaagttgtggagaggagggaatctgggagtggatatccacagcatgctatcaaaacctccaattattaatgggtttgtggagatacttttcaattct |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43451960 |
agagaaattgtggagaggagggaatctgggagtggatatccacagcatgctatcaaaacctccaattattaatgggtttgtggagatacttttcaattct |
43452059 |
T |
|
| Q |
214 |
gttgaaccccaggttcttcaggcagcagttttccttctggctgagatg |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43452060 |
gttgaaccccaggttcttcaggcagcagttttccttctggctgagatg |
43452107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University