View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5911_high_40 (Length: 250)
Name: NF5911_high_40
Description: NF5911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5911_high_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 6 - 231
Target Start/End: Original strand, 7502429 - 7502654
Alignment:
| Q |
6 |
acctccattagcaaatatcaacaaaacattagcattagggttatctagagcccacagtgacatatcagtaataatctttttgtaacattcatcaaagtaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7502429 |
acctccattagcaaatatcaacaaaacattagcattagggttacctagagcccacagtgacatatcagtaataatctttttgtaacattcatcaaagtaa |
7502528 |
T |
|
| Q |
106 |
ctatcagagacgctagtgacgtgatggacggagatgcctgtggaggaaagcgcgtttagaatttcactggcgatgagattggtgtctccgtaagctgaaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7502529 |
ctatcagagacgctagtgacgtgatggacggagatgcctgtggaggaaagcgcgtttagaatttcactggcgatgagattggtgtctccgtaagctgaaa |
7502628 |
T |
|
| Q |
206 |
tggaaagttctccaagaaggtttgct |
231 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7502629 |
tggaaagttctccaagaaggtttgct |
7502654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 142 - 224
Target Start/End: Original strand, 7499231 - 7499313
Alignment:
| Q |
142 |
cctgtggaggaaagcgcgtttagaatttcactggcgatgagattggtgtctccgtaagctgaaatggaaagttctccaagaag |
224 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||| | |||||||| ||| ||| |||| |
|
|
| T |
7499231 |
cctgtggaggaaataccgtttagaatttcactggagatgagattggtgtctccataagccgtaatggaaatttcgccatgaag |
7499313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University