View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5911_high_47 (Length: 239)
Name: NF5911_high_47
Description: NF5911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5911_high_47 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 43452308 - 43452087
Alignment:
| Q |
18 |
aaccaagtcttcctctttcttattgaaaacggctatgagggactctactacggccatctcagtaagagtcacagtggatgggtttaggacatacagtagc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43452308 |
aaccaagtcttcctctttcttattgaaaacggctatgagggactctactacggccatctcagtaagagtcacagtggatgggtttaggacatacaatagc |
43452209 |
T |
 |
| Q |
118 |
acaacagcttctgtcaaccctttcttgaaaagagccattatacattcaacgtcggtatccacgcgtgttagagtctgaataacagaattgtctctagatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43452208 |
acaacagcttctgtcaaccctttcttgaaaagagccattatacattcaacgtcggtatccacgcgtgttagagtctgaataacagaattgtctctagatc |
43452109 |
T |
 |
| Q |
218 |
ccatctcagccagaaggaaaac |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43452108 |
ccatctcagccagaaggaaaac |
43452087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University