View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5911_high_50 (Length: 236)
Name: NF5911_high_50
Description: NF5911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5911_high_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 27231455 - 27231232
Alignment:
| Q |
1 |
gcaaacacaatagatccagtgatggaatcacaaacaaccaaccagaaaacaccagacccaacacaacaac-atgacctccgcaaacctttgaacgcactg |
99 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
27231455 |
gcaaacacaatagatccagtgatcgaatcacaaacaaccaaccagaaaacaa-agacccaacacaacaactatgacctccgcaaacctttgaacg-actg |
27231358 |
T |
 |
| Q |
100 |
caaacgaggacgattgaaacatgctggaggtcggatcgctgaaaagagaaggttgtga-ggtgtggtggaggaaagatctcattgcaccaccatccttga |
198 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||| |||||| |||||||||||||||||||| |||||| |
|
|
| T |
27231357 |
caaacgaggacgattgaaacatgccggaggtcggatcgctgaaaagagaagggtgtgatggtggtgtggagataagatctcattgcaccaccacccttga |
27231258 |
T |
 |
| Q |
199 |
tatttgcatctgggatgttgagtttg |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
27231257 |
tatttgcatctgggatgttgagtttg |
27231232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 25 - 127
Target Start/End: Complemental strand, 27237330 - 27237229
Alignment:
| Q |
25 |
gaatcacaaacaaccaaccagaaaacaccagacccaacacaacaacatgacctccgcaaacctttgaacgcactgcaaacgaggacgattgaaacatgct |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||| |||| ||||| || ||||| || |||||||||| |
|
|
| T |
27237330 |
gaatcacaaacaaccaaccagaaaacaccaaacccaacacaacaacgtgacctctgcaaacctttaaacg-actgcgaatgaggatgaccgaaacatgct |
27237232 |
T |
 |
| Q |
125 |
gga |
127 |
Q |
| |
|
||| |
|
|
| T |
27237231 |
gga |
27237229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University