View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5911_high_52 (Length: 218)
Name: NF5911_high_52
Description: NF5911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5911_high_52 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 34414031 - 34414239
Alignment:
| Q |
1 |
ctgagcatgaaaagggtgcaatcttttcagtccataagagaagaagaagtagcagaaattgttaatactttaaaggaagcatgtgcaagtgctagtaaag |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34414031 |
ctgagcatgaaaaggatgcaatcttttcagtccataagagaagaag---tagcagaaattgttaatactttaaaggaagcatgtgcaagt------aaag |
34414121 |
T |
 |
| Q |
101 |
agtcttctacagtgaatctgagtgagatgctgattgcagcctcaaataacatagtttcaaggtgtgttcttggacaaaagtatgatacaccagttggtag |
200 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34414122 |
agtcttctatagtgaatctgagcgagatgctgattgcagcctcaaataacatagtttcaaggtgtgttcttggacaaaagtatgatacaccagttggtag |
34414221 |
T |
 |
| Q |
201 |
tggtagctttggagagtt |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34414222 |
tggtagctttggagagtt |
34414239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University