View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5911_low_23 (Length: 308)
Name: NF5911_low_23
Description: NF5911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5911_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 2 - 303
Target Start/End: Original strand, 2892657 - 2892954
Alignment:
| Q |
2 |
tgtgatactggatactttcaatacaacaaaacaaggaattaacatgttcaatcaaattcgactctaattattcatacttgtcttaaacatataagtacaa |
101 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2892657 |
tgtgatactggatactttcaataaaacaaaacaaggaattaacatgttcaatcaaattcgactctaattattcatacttgtcttaaacatataagtacaa |
2892756 |
T |
 |
| Q |
102 |
ggtacataaccagaatacaacatagttcttcacaatggataatcaaaacacatgtcttaatcattaaggacataatatgattatgatatatagggagcta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2892757 |
ggtacataaccagaatacaacatagttcttcacaatggataatcaaaacacatgtcttaatcattaaggacataatatgattatgatatatagggagcta |
2892856 |
T |
 |
| Q |
202 |
catgataactcatatcagtcaacaaacatgaaatttcatgagataaaacataagacacaactaagcttcaactaaatggccttctctttcccctttgcta |
301 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| || |
|
|
| T |
2892857 |
catgataactcatatcagtc----aacatgaaatttcatgagataaaacataagacacaactaagcttcaagtaaatggccttctccttcccttttgata |
2892952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University